Want to make creations as awesome as this one?

Transcript

Activité 1 - La mesure de la biodiversité: mesurer les espèces inconnues à partie de celles connues

le projet TARA
Séance en salle informatique.
Se mettre par groupe de 4

Maud Guyot -professeur SVT Lyon et
Mickaël. Micoud- Professeur SVT Lille

Missions

les métiers

On estime à 8.7 millions le nombre d'espèces inconnues...Comment expliquer ce paradoe de povoir donner un chiffre sur des espèces non identifiées!?
C'est un des objectifs du projet TARA

Travail en classe jeudi 24 mars ou lundi 28 - ramassé et noté.

Par groupe de 4 .

Envoyé votre travail sur école directe

1ère étape : identifier les espèces à partir de l´ADN environnemental recueilli

2ème étape : traiter les données numériques pour estimer la richesse spécifique et l´abondance des taxons

Bilan : communication scientifique des résultats et interprétations

Protocole

Protocole :

Dans le cadre « Enter accession number(s), gi(s), or FASTA sequence(s) », coller ou recopier votre séquence d’ADN à identifier.

Cliquer sur « BLAST ».

Noter le nom du taxon identifié à 100 %.

Recommencer avec les autres séquences.

Carte des données récoltées et traitées

analyses génétiques des échantillons d'eau récoltés dans l'océan indien
à traiter

Lien du logiciel Blast

Video sur les méthodes de prélèvements

Etape 1: Objectif : identifier les espèces récoltées dans les échantillons d'eau de l'océan indien

Carte des expéditions et résultats obtenus par le goélette TARA

Déterminer la biodiversité spécifique dans une station de l'océan Indien


un taxon est une entité regroupant tous les organismes vivants possédant en commun certaines caractéristiques bien définies. Le terme taxon est utilisé dans la classification phylogénétique pour regrouper des êtres vivants en fonction de divers critères.

NB: sp= espèce; uncultured = non connue


  • Fichier de séquences :
    • 448380 séquences du Taxon n° 1
      CGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGTAACAGGTCTAGCTTGCTAGATGCTGACGAGTGGCGGACG-GGTGAGTAACGCGTAGGAATCTACCCCGCGGTGGGGGATAACACGAGGAAACTCGTGCTAATACCGCATACGCTCTA-CGGAGGAAAATTTTTTTGCCGTGGGATGAGCCTGCGTTAGATTAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGAT-GATCTATAGCTGTTCTGAGAGGAAGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCA-GTGGGGAATCTTGGACAATGGGGGAAACCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCTGCGGGTTGTAAA

    • 24780 séquences du Taxon n° 2
      GAGCAGTGCGCTCTCCTGGTGGACGGTTTCGTGGCTGGCCCCACGGCCGTGGCGACAGCGCGCCGCAACTTCCCC-CGTCAGTGGCTGCACTACCATCGCGCCGGCCACGGCATGATCACCTCCCCCCAGACCCAGCGAGGCTACACCGCCC-TGGTACTCTCCAAGTTCTCGCGATTGCTCGGCTCGTCGGGTATCCACGTCGGCACCATGGGCTTCGGCAAGNTGGAGTC

    • 14160 séquences du Taxon n° 3:
      TAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCACAGGGTTTTATTCTTTTCTTTTTATG-TAAATAAGAATGTTTTATGTAGATTAAACCGACTTTTAATTCTTTAAATTAAAGGAAGTTTGTGGCAATAACAGGTC

    • 30680 séquences du taxon 4
      CGGTAATTCCAGCTCCAATAGCGAATGCTAATTTTGCTGCAGTTAAAAAGCTCGTAGTCGATTTCTGGTA
      GAATAATTAATATCCTTTGGATGAATGTCTATTGTTTTTGATTTTAATTATTTGGCCATATATTTTTTCT

Video sur les méthodes de prélèvements

Obj1: Comprendre ce qu'est de l'ADN environnemental

Protocole

Protocole :

Dans le cadre « Enter accession number(s), gi(s), or FASTA sequence(s) », coller ou recopier votre séquence d’ADN à identifier.

Cliquer sur « BLAST ».

Noter le nom du taxon identifié à 100 %.

Recommencer avec les autres séquences.

analyses génétiques des échantillons d'eau récoltés dans l'océan indien
à traiter

Lien du logiciel Blast

Video sur les méthodes de prélèvements

Objectif 2 : identifier (nommer) les espèces récoltées dans les échantillons d'eau de l'océan indien grâceà l'ADN environnemental

Déterminer la biodiversité spécifique dans une station de l'océan Indien


un taxon est une entité regroupant tous les organismes vivants possédant en commun certaines caractéristiques bien définies. Le terme taxon est utilisé dans la classification phylogénétique pour regrouper des êtres vivants en fonction de divers critères.

NB: sp= espèce; uncultured = non connue


  • Fichier de séquences :
    • 448380 séquences du Taxon n° 1
      CGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGTAACAGGTCTAGCTTGCTAGATGCTGACGAGTGGCGGACG-GGTGAGTAACGCGTAGGAATCTACCCCGCGGTGGGGGATAACACGAGGAAACTCGTGCTAATACCGCATACGCTCTA-CGGAGGAAAATTTTTTTGCCGTGGGATGAGCCTGCGTTAGATTAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGAT-GATCTATAGCTGTTCTGAGAGGAAGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCA-GTGGGGAATCTTGGACAATGGGGGAAACCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCTGCGGGTTGTAAA

    • 24780 séquences du Taxon n° 2
      GAGCAGTGCGCTCTCCTGGTGGACGGTTTCGTGGCTGGCCCCACGGCCGTGGCGACAGCGCGCCGCAACTTCCCC-CGTCAGTGGCTGCACTACCATCGCGCCGGCCACGGCATGATCACCTCCCCCCAGACCCAGCGAGGCTACACCGCCC-TGGTACTCTCCAAGTTCTCGCGATTGCTCGGCTCGTCGGGTATCCACGTCGGCACCATGGGCTTCGGCAAGNTGGAGTC

    • 14160 séquences du Taxon n° 3:
      TAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCACAGGGTTTTATTCTTTTCTTTTTATG-TAAATAAGAATGTTTTATGTAGATTAAACCGACTTTTAATTCTTTAAATTAAAGGAAGTTTGTGGCAATAACAGGTC

    • 30680 séquences du taxon 4
      CGGTAATTCCAGCTCCAATAGCGAATGCTAATTTTGCTGCAGTTAAAAAGCTCGTAGTCGATTTCTGGTA
      GAATAATTAATATCCTTTGGATGAATGTCTATTGTTTTTGATTTTAATTATTTGGCCATATATTTTTTCT

Objectifs 3: Traiter les données pour les communiquer scientifiquement par un tableur libre office

Resssources définition richesse spécifique

fiche technique libreoffice

Exemple avec des espèces planctoniques récoltées dans toutes les stations étudiées



Exemple de graphiques à construire avec les quatre stations que vous avez étudiées

C'est sur ce modèle que vous allez construire votre graphique avec les données de l'océan Indien à disposition



Travail final attendu


Par groupe d'étudiants-chercheurs inscrits, vous êtes chargés de rédiger un petit article d´une demi-page pour la revue "Pour La Science" dans lequel vous présenterez les résultats de votre recherche.

Votre article devra comprendre une présentation rapide des méthodes utilisées, les résultats obtenus communiqués scientifiquement, ainsi que des hypothèses concernant les différences de biodiversité constatées dans les 3 océans étudiés (Atlantique et Pacifique déjà traités, et l'océan indien que vous avez étudié).

Vous terminerez votre article en soulignant l'importance du projet Tara dans le cadre de la recherche de l'estimation de la biodiversité actuelle.

Pour accéder aux critères de réussite de l'article

les métiers sur Tara

Critères de réussite de l'activité 1

Communiquer sur sa démarche, ses résultats et ses choix en argumentant à l'écrit

Communiquer ses résultats dans un langage scientifique (tableau et graphique)

Raisonner avec rigueur, interpréter des résultats en mobilisant ses connaissances, conclure

  • mon article présente un titre pertinent (adapté au sujet)
  • mon article présente les méthodes utilisées par les scientifiques et le cadre du projet de recherche
  • le texte est pertinent (en lien avec le problème à résoudre et les études menées).
  • les informations données sont justes et extraites des études réalisées
  • le texte est structuré en phrases qui ont du sens
  • l’orthographe et la grammaire sont respectées
  • des connecteurs logiques sont utilisés à bon escient

  • Le graphique obtenu est inséré avec le choix des axes pertinent
  • les fonctionnalités des logiciels (BLAST et tableur) ont été bien utilisées afin d'obtenir des résultats corrects
  • les légendes sont exactes
  • un titre en cohérence avec la relation exprimée par le graphique est donné

  • les résultats et les informations en lien avec le problème posé sont relevés
  • des valeurs extraites du tableur et du graphique sont citées
  • les notions de richesse spécifique et d'abondance relative sont construites sur les données de l'expédition
  • Une explication de l'intérêt des métadonnées dans la découvertes de la biodiversité actuelle est explicitée