Want to make creations as awesome as this one?

Room scape St Jordi 2020

More creations to inspire you

ANIMALS AND PLANTS

Breakout

THE MUGGLE AT HOGWARTS

Breakout

SPACE INVADERS GAME

Breakout

HALLOWEEN BREAKOUT

Breakout

BREAKOUT PAZ

Breakout

MINERALS AND ROCKS

Breakout

PATHFINDER: RETURN OF THE RUNELORDS

Breakout

Transcript

,room Escape,Seràs capaç d'arribar a descobrir què ha passat a l'Institut Carles Vallbona el dia de Sant Jordi?,INTRODUCCIÓ,MAPA,El misteri del drac,INICI,PERSONATGES,Introducció,El dia 23 d'abril de 2020 l'Institut Carles Vallbona està buit, aquest any estranyament no hi ha alumnes. El drac de Sant Jordi ha aprofitat per entrar a l'Institut. Algunes professores de 1r d'ESO estan recollint pistes de què pot haver fet aquest drac dins l'institut però necessiten la teva ajuda per resoldre-ho.,Endinsa't en l'aventura del drac i descobreix què ha passat dins l'institut.,· Laboratori de biologia i geologia,· Aula d'orientació,· Aula de matemàtiques,Mapa de l'institut,· Aula d'anglès,En diferents aules de l'institut les professores de 1r d'ESO han trobat algunes pistes que t'ajudaran a resoldre el misteri del drac,· Aula de castellà,· Aula de música,· Laboratori de física i química,Coneix els personatges de la història,Personatges,Laiala professora de Ciències de la naturalesa,Mariala professora de Sostenibilitat,Annala professora de Mates,Montsela professora d'Educació Emocional,Aurorala professora de Música,Carmela professora de Castellà,Núriala professora d'Anglès,Sílviala professora de Mates,A partir d'aquí ja no podeu fer marxa enrere!L'aventura comença en tres, dos, un...,Esteu preparats?,Laboratori de Biologia i Geologia,Mentre rondava per l’institut, el drac ha perdut algunes escames. Des del laboratori de biologia i geologia, la professora de ciències de la naturalesa, la Laia, ha volgut aprofitar les escames per analitzar l’ADN d’aquest increïble animal.Com ja sabeu l’ADN és la informació que contenen totes les cèl·lules per fer les seves funcions i que determina les característiques de qualsevol ésser viu. Els científics representen aquesta informació combinant quatre lletres: A, T, C i G. Cada agrupació de 3 lletres dóna la informació d’un fragment d’una proteïna.La Laia ha extret l’ADN de les escames, ha realitzat una tècnica que amplifica molt la quantitat d’ADN que es diu PCR i, mentre analitzava el resultat, ha descobert un missatge ocult en el seu codi genètic...Bona sort en la vostra primera missió! Que la força del drac us acompanyi!,01,missió 01,comprova,Analitza el fragment del codi genètic del drac utilitzant el següent descodificador i descobreix el missatge ocult que t’ajudarà a resoldre aquesta missió. Exemple de descodificació: AGC = su,TTAAAGGCTCGAATCTCCGTGCTAGGGTTCACCCCAGATTGC,Tens la solució?,01,Laboratori de Biologia i Geologia,plÀnol de l'inSTITUT,Respon correctament l'enigma i descobriràs el símbol que et portarà al pròxim escenari del drac,Descodificador d'adn de drac,Clica aquí per ampliar el plànol,NO FACIS TRAMPES!,EL DRAC ET VIGILA,TORNAR A LA MISSIÓ,02,Passant del laboratori de biologia i geologia al de física i química, el drac s’ha trobat a la Maria fent un experiment de química. El drac s’ha espantat tant que ha reaccionat escopint una bola gegant de foc. La professora ha aprofitat per analitzar els gasos que ha emès el drac, per veure si trobava alguna informació que ens pogués ajudar a saber què hi fa el drac al nostre institut.La Maria ha trobat en el fum del drac diferents molècules que formen 4 gasos d’efecte hivernacle. Com sabeu aquests gasos són responsables de l'escalfament global del planeta. Només ens faltava que, a part de la contaminació que generem nosaltres, els dracs també hi contribueixin. Quin desastre medi ambiental tot plegat!,Laboratori de Física i Química,missió 02,eFECTE HIVERNACLE,Podries ajudar a la Maria a formar els 4 gasos d'efecte hivernacle a partir de les molècules trobades?,Tens la solució?,02,Laboratori de Química i Física,Respon correctament l'enigma i descobriràs el símbol que et portarà al pròxim escenari del drac,comprova,EL DRAC ET VIGILA,M'estàs fent enfadar!,TORNAR A LA MISSIÓ,Aula de matemàtiques,03,Amb tantes escames perdudes, no sabem si el drac ha quedat moltdèbil,per comprovar-ho, la Sílvia i l'Anna han recollit les escamesper comptar-les.Han anat a l'aula de Matemàtiques i amb les 48 escames recollideshan fet 3 piles sobre la taula. Han deixat un missatge pels alumnes, quehauran de resoldre per seguir amb la missió.,missió 03,La Sílvia i l'Anna us han deixat el següent missatge:Quantes escames hi havia en cada pila al principi?,Aula de matemàtiques,03,"No us direm quantes escames hem posat a cada pila, però us donarem les següents pistes: Si de la primera pila passem a la segona tantes escames com té la segona, després passem de la segona a la tercera tantes com hi ha a la tercera i, finalment, de la tercera passem a la primera tantes escames com hi ha ara a la primera, hi haurà el mateix nombre d'escames a totes tres piles".,comprova,Tens la solució?,Respon correctament l'enigma i descobriràs el símbol que et portarà al pròxim escenari del drac,1a?,2a?,3a?,qui juga amb foc es crema!,EL DRAC ET VIGILA,TORNAR A LA MISSIÓ,Aula de música,L'Aurora s'ha deixat la gravadora de sons engegada de feia dies a l'aula de música i ha pogut enregistrar el cant de drac.La partitura del seu cant ha resultat ser un divertit jeroglífic, quina ciutat catalana s'amaga a la partitura?I parlant de ciutats, quina ciutat italiana correspon a la 1a i la 2a corda de l'ukelele?,04,missió 04,Respon correctament l'enigma i descobriràs el símbol que et portarà al pròxim escenari del drac,Tens la solució?,comprova,EL DRAC ET VIGILA,te l'estàs jugant!,TORNAR A LA MISSIÓ,El drac sembla que s'ha desorientat una mica i voltant per l'institut ha anat a parar a l'aula de la Montse. A la seva manera ha intentat explicar una història a la pissarra amb unes sèries de dibuixos que no han quedat inacabades.,Aula d'orientació,04,missió 04,Clica la figura que continua la sèrie,Tens la solució?,EL DRAC ET VIGILA,has fallat!torna-ho a intentar!,TORNAR A LA MISSIÓ,Aula d'orientació,Ups! sembla que hi ha més sèries per resoldre! Ara ja hi tens pràctica!,04,missió 04,Clica la figura que continua la sèrie,Tens la solució?,TORNAR A LA MISSIÓ,has fallat!torna-ho a intentar!,EL DRAC ET VIGILA,Això ja ho tens dominat! L'última sèrie i la missió serà teva!,Aula d'orientació,04,missió 04,Clica la figura que continua la sèrie i descobreix el següent escenari del drac,Tens la solució?,has fallat!torna-ho a intentar!,TORNAR A LA MISSIÓ,EL DRAC ET VIGILA,Aula de castellà,Després de cantar a l'aula de música, el drac ha marxat cap a una aula de castellà. La Carme abans de marxar de l'institut estava preparant unes endevinalles i pel que sembla amb una bufada del drac ha sortit volan el full de les solucions.Resol les endevinalles de la Carme per aconseguir la missió:,06,missió 06,Respon correctament l'enigma i descobriràs el símbol que et portarà al l'últim escenari del drac,Tens la solució?,comprova,ADIVINANZA 1: "Una cajita blanca como la cal. Todos la saben abrir pero nadie cerrar. ¿Qué es?"ADIVINANZA 2: Doce señoras. Todas con medias y sin zapatos. ¿De qué hablamos?ADIVINANZA 3: Todos pasan por mí, yo no paso por nadie. Todos preguntan por mí, yo no pregunto por nadie. ¿Quién soy?,EL DRAC ET VIGILA,Tinc amics perillosos!,TORNAR A LA MISSIÓ,Aula d'anglès,missió 07,La Núria ha entrat en una aula, l'ordinador estava engegat, el canó també i a la pissarra de classe hi havia el següent missatge projectat...,07,"Saint George is the patron saint for the English people. And it’s the Lover’s Day in Catalonia. Núria is reading the story of the two most famous lovers in English literature, but she has some doubts. Can you help her? Press the rose to begin".,Respon correctament l'enigma i descobriràs el símbol que et portarà al desenllaç del misteri del drac,07,Aula d'anglès,comprova,Tens la solució?,EL DRAC ET VIGILA,No siguis poruc, resol la missió!,TORNAR A LA MISSIÓ,,HAS ACONSEGUIT RESOLDRE TOTES LES MISSONS AMB ÈXIT!,sI VOLS SABER COM ACABA AQUESTA HISTÒRIA CLICA ELS ULLS DEL DRAC,mOLTES FELICITATS!,Després de moltes voltes per l'institut, sembla que el drac va aconseguir deixar el missatge que havia vingut a portar al alumnes de 1r d'ESO. I és que les professores havien recopilat moltes pistes per dins l'institut però no havien mirat el pati. Penjada en una porteria de futbol hi havia una gran pancarta amb el següent missatge...,Veure el missatge del drac,L'equip docent de 1r d'ESO us desitgem un Feliç Sant Jordi i esperem poder-vos tornar a veure en directe ben aviat!,Moltes gràcies per la vostra participació al Room Escape "El misteri del drac". Esperem que hagueu passat una bona estona!